%0 Journal Article
%T Molecular characterization of Salmonella isolated from internal organs of dead turkey and its antimicrobial activity pattern
%A Md Aoulad Hosen
%A Md Shajedur Rahman
%A Nazmi Ara Rumi
%A Tonmoy Kundu
%J Asian Journal of Medical and Biological Research
%D 2019
%R https://doi.org/10.3329/ajmbr.v5i3.43591
%X Salmonella enterica is a zoonotic pathogen which can readily pass from animal to man through the consumption of contaminated food. This study was designed to determine molecular characterization of Salmonella and antibiotic resistance profiles of Salmonella recovered from internal organs of dead turkey. A total of 40 internal organ samples from dead turkey were collected from different turkey farms in Dinajpur district. Among the samples 12 (30%) were positive for Salmonella. Salmonella virulence factors were determined using the polymerase chain reaction assays targeting the virulence gene &16S rRNA gene region was amplified with the universal primers, forward primer- 27F (5'AGAGTTTGATCCTGGCTCAG 3') and reverse primer- 1492R (5' TACCTTGTTACGACTT 3'). PCR amplification band was found at 1470 bp. Among the different serotypes, Salmonella enterica was identified by using phylogenetic tree analysis. Antibiotic resistance analysis indicates that Salmonella spp. were 100% sensitive to Azithromycin, Kanamycin, Norfloxacin and Chloramphenicol. The isolates were 100% resistant to Cefradine, Cloxacillin, Bacitracin, Levofloxacin, Amoxicillin, Nalidixic acid and Tetracycline. In conclusion, this study provides that the isolated Salmonella spp. were found to AMR in response to variety of multi drugs. Salmonella enterica can cause a wide range of illnesses, ranging from gastroenteritis to acute, life-threatening enteric fever for turkey. This study suggests that turkeys may act as a reservoir for these strains which can be transferred to humans
%U https://www.banglajol.info/index.php/AJMBR/article/view/43591